Laryngology
Published: 2023-02-27
download
PDF

Angiotensin-converting enzyme insertion/deletion gene polymorphism in patients with laryngeal cancer

Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey
https://orcid.org/0000-0002-0713-2933
Department of Medical Genetics, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey
https://orcid.org/0000-0002-7075-8875
Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey
https://orcid.org/0000-0002-5470-6784
Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey
https://orcid.org/0000-0002-0050-4837
Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey
https://orcid.org/0000-0002-2396-6794
Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey
https://orcid.org/0000-0003-2071-1451
laryngeal cancer lymphatic metastasis angiotensin converting enzyme gene polymorphism

Abstract

Objectives. The aim of this study was to compare the distribution of the angiotensin-converting enzyme (ACE) I/D polymorphism between patients with laryngeal cancer (LC) and a control group and to examine the distribution of this polymorphism with clinical parameters related to LC.
Methods. We enrolled 44 LC patients and 61 healthy controls. The ACE I/D polymorphism was genotyped with the PCR-RFLP method. The distribution of ACE genotypes (II, ID, and DD) and alleles (I or D) was evaluated with Pearson’s chi-square test, and logistic regression analysis was performed for statistically significant parameters.
Results. There was no significant difference in ACE genotypes and alleles between LC patients and controls (p = 0.079 and p = 0.068, respectively). Among clinical parameters related to LC (extension of tumour, node metastasis, tumour stage and tumour location), only the presence of node metastasis was found to be significant in terms of ACE DD genotype (p = 0.137, p = 0.031, p = 0.147, p = 0.321 respectively). In the logistic regression analysis, the ACE DD genotype was increased 8.3 fold in nodal metastases.
Conclusions. The findings of the study suggest that ACE genotypes and alleles do not affect the prevalence of LC, but the DD genotype of ACE polymorphism may increase the risk of lymph node metastasis in LC patients.

Introduction

Squamous cell carcinoma is the most common type of laryngeal cancer (LC), accounting for 85% to 95% of all malignant neoplasms 1. In 2021, the estimated number of new cases diagnosed with LC in the US was 12,620, and LC accounted for 0.7% of all new cancer cases. Again in 2021, the estimated deaths due to LC were 3,770 individuals and LC accounted for 0.6% of all cancer deaths 2. Despite the improvements in diagnosis and treatment, survival rates are still low. While the 5-year survival rate for LC was 66% in the 1970s, it decreased to 60.7% in 2017 2,3. The reason for treatment failure is mostly advanced stage disease at the time of diagnosis. Therefore, otolaryngologists, radiation oncologists and medical oncologists are constantly seeking to improve survival.

Angiotensin-converting enzyme (ACE) is a zinc metallopeptidase that converts angiotensin I (AT-1) to angiotensin II (AT-2) and reduces bradykinin; hence, it controls blood pressure and cardiovascular homeostasis 4. An insertion/deletion (I/D) polymorphism consisting of 287 base pairs is defined in intron 16 of the ACE gene located on chromosome 17q23 5. The D allele is associated with higher ACE plasma concentrations than the I allele 5,6. Thus, the DD genotype correlates with AT-2 levels. Higher AT-2 levels are also associated with neovascularisation, cell proliferation, inflammation and possibly cancer development 4,7.

In previous studies, the association of ACE gene polymorphism types (DD, ID, or II) with various cancers and clinical findings in cancer patients was investigated. Carriers of the DD genotype for the ACE gene were shown to be at risk for breast and squamous cell lung cancer, and for lymph node metastasis in those with gastric cancer 4,8,9. A relationship between ACE gene polymorphism and colorectal, lung, and prostate cancer was not demonstrated 4,8. As a result, data on ACE gene polymorphisms and development of cancer (regardless of cancer type) are inconsistent.

Finding a relationship between ACE gene polymorphisms and development of LC or parameters associated with LC [e.g., tumour (T), node (N)] might help prevent and slow progression of the disease, thus contributing to increased survival. Our study was conducted to reveal the frequency of ACE I/D polymorphism in LC and to investigate relationships with clinical findings. To the best of our knowledge, this is the first study to reveal a relationship between ACE I/D polymorphism and LC.

Materials and methods

The study was carried out between September 2020 and September 2021 at the Department of Otorhinolaryngology and Medical Genetics at Süleyman Demirel University Faculty of Medicine, Isparta, Turkey.

Subjects

All clinical and pathological parameters were collected by chart review. The criteria for inclusion in the LC group were as follows: 1. histopathological diagnosis of laryngeal squamous cell carcinoma; 2. regular smoker; and 3. data on clinical parameters [e.g. tumour (T), node (N), metastasis (M) classification, and location of tumour, according to the AJCC Cancer Staging Manual, 8th Edition] 10. The criteria for inclusion in the control group were as follows: 1) no history of malignancy; 2) regular smoker; 3) undergoing septoplasty surgery at the otolaryngology clinic; 4) a normal laryngeal examination prior to surgery. In both groups, patients with a history of use of ACE inhibitors and/or AT receptor blockers and patients with genetic diseases involving predisposition to malignancy were excluded. Descriptive information was collected on the age, gender, tumour localisation, TNM classification and stage. The frequency of II, ID and DD genotypes and I/D alleles of the ACE gene in patients diagnosed with LC were compared with the control group. In addition, the clinical findings of patients diagnosed with LC were analysed in terms of genotype and allele frequency. For genetic analysis, 4 cc venous blood was taken from all patients in the study group into tubes containing EDTA during routine preoperative examinations. Samples were stored at -20°C in the medical genetics laboratory until DNA isolation.

Genotyping

DNA from venous blood samples was obtained using the High Pure Polymerase Chain Reaction (PCR) Template Preparation kit (Roche Applied Science, Germany) according to the manufacturer’s protocol. The concentration and purity of the obtained DNA samples were determined by measuring with a Nanodrop 2000c spectrophotometer (Thermo Scientific, USA). The A60/280 absorbance ratio for DNA was in the range of 1.8-2.0. Polymerase chain reaction was performed of each DNA sample with ACE gene I/D polymorphism genotype allele specific primers (Forward: TGGAGACCACTCCCATCCTTTCT, Reverse: GATGTGGCCATCACATTCGTCAGAT) and FastStart High Fidelity PCR System, dNTPack (Roche Applied Science, Germany) kit. Each polymerase chain reaction contains 10 pmol of F and R primers, 1.8 mM MgCl2, 10 mM dNTP mixture, 1.25 U Taq polymerase and 250 ng genomic DNA. The polymerase chain reaction was carried out under the following conditions; after 10 minutes of pre-incubation at 94°C, 35 cycles at 94°C for 2 minutes, 57°C for 30 seconds, 72°C for 1 minute, and finally at 72°C for 7 minutes. After the PCR, 2% agarose gel electrophoresis was applied to the products and stained with GelRed Nucleic Acid Gel Stain (Biotium, USA). The gel was visualised with a UV Transilluminator. I and D polymorphism genotypes of ACE gene in the samples were determined as II genotype single band 490 bp, ID genotype double band 190 bp and 490 bp, and DD genotype single band 190 bp (Fig. 1).

Statistical analysis

Data was analysed by using SPSS Statistics for Windows, Version 23.0 (IBM SPSS. Armonk, NY: IBM Corp). In descriptive findings, categorical variables are presented as number and percentage, and continuous variables are presented as mean ± standard deviation. Whether the age variable was normally distributed or not was evaluated with the Kolmogorov-Smirnov test and compared between groups with the independent samples t test. Since the study group consisted of only males, the gender variable was not included in the analysis. Pearson chi-square test was used when examining the relationship of ACE genotypes and alleles between patients with LC and the control group. Similarly, the relationship of ACE genotypes and alleles with clinical parameters in LC patients was evaluated with the Pearson chi-square test. Variables that were statistically significant in univariate analysis were evaluated with logistic regression analysis. The ID genotype was taken as a reference. Results are presented with odds ratio (OR) and 95% confidence intervals (CI). Statistical significance was accepted as p < 0.05.

Results

In this study, 44 patients with LC and 61 healthy controls were enrolled. There were no female patients in either group. The mean age of patients with LC was 62.73 ± 9.05 years, while it was 61.93 ± 7.48 years in the control group. There was no significant difference between groups in terms of age (p = 0.625). The characteristics of study subjects are shown in Table I (none of the LC patients had distant metastases at initial diagnosis). Table II shows the frequency distribution of ACE genotypes and alleles among patients with LC and controls. There was no significant difference between ACE genotypes and alleles between LC patients and controls (p = 0.079 and p = 0.068, respectively). In addition, the relationship between the distribution of ACE genotypes and alleles in patients with LC and clinical parameters is presented in Table III.

Discussion

ACE is the key molecule involved in the formation of AT-2 from AT-1 and the inactivation of bradykinin. The hypothesis that increased levels of AT-2 may play a role in the development of any cancer has been hypothesised especially for type 1 receptors of AT-2, because they can contribute to cell proliferation, angiogenesis, inflammation and cell migration through various signal transduction pathways 7. Previous studies showed that the D allele in the ACE gene polymorphism is associated with higher ACE levels 5,6, meaning also high levels of the AT-2 and AT-2 type 1 receptors. In this context, the relationship between ACE I/D gene polymorphism and many solid cancer types was investigated in several studies 4,7,9,11-13 and it is worth investigating also for LC.

A relationship was found between ACE I/D gene polymorphism and the development of prostate, breast, endometrial cancers and oral precancerous lesions. In these studies, it was shown that the presence of the D allele increases the risk of cancer. It is thought that malignant transformation is triggered after long-term exposure to the high amount of AT-2 formed in the DD genotype of the ACE gene in normal tissues 14-17. It is known that AT-2, which has high levels in the malignant transformation process, activates some intracellular signal transduction pathways (e.g., transforming growth factor B, phosphoinositide 3-kinase, mitogen activated protein kinase/extracellular signal-regulated kinase, Janus kinase-signal transducer and activator of transcription, protein kinase C and rat sarcoma protein). This process occurs when AT-2 stimulates these pathways directly or via epidermal growth factor. Another reason thought to be related to tumourigenesis is the high reactive oxygen species formed by AT-2 in tissues 7. In our study, no significant difference was found between LC and the control group in terms of the distribution of ACE I/D gene polymorphisms. Similarly, in our study, no relationship was found between the distribution of ACE I/D gene polymorphisms and parameters such as T stage or tumor location. We attribute this to the fact that environmental factors such as smoking are more effective than genetic factors for the development of LC.

One of the most important factors determining the prognosis in LC patients is cervical lymph node metastasis 18. Therefore, one way to increase survival is to focus on factors that prevent lymph node metastasis or, if metastasis has occurred, to stabilise the metastasis. In a study in gastric cancer patients, there was no difference when ACE I/D polymorphisms were compared with the control group, but it was shown that the number of metastatic lymph nodes was higher with the DD genotype than with the II genotype 9. In patients with colorectal carcinoma, it was reported that the DD genotype of the ACE gene increases the risk of lymph node metastasis 19. In another study in patients with endometrial cancer, no relationship was found between lymph node metastasis and the ACE I/D gene polymorphism. However, the low number of patients with lymph node metastases in this study may have affected the statistical analysis 13. In most of the above-mentioned studies, it was shown that the DD genotype of the ACE gene is associated with increased lymph node metastasis. Angiogenesis is required for an invasive tumour to metastasise and the balance between proangiogenic factors and anti-angiogenic factors should be disturbed in favour of proangiogenic factors for angiogenesis. One of the proangiogenic factors is vascular endothelial growth factor 20. Previous studies showed that AT-2 has a stimulating effect on vascular endothelial growth factor 21. We think that the increased risk of cervical lymph node metastasis is due to the high AT-2 levels occurring in the DD genotype of the ACE gene. In the current study, the risk of cervical lymph node metastasis in patients with LC with the DD genotype of the ACE gene was also found to be 8.3 times higher than the other genotypes.

The pathophysiological mechanism of the susceptibility of the ACE gene DD genotype for lymph node metastasis should be elucidated further because this intervention may enable ACE inhibitors to be included in treatment protocols to prevent lymph node metastases and/or their spread. It was shown that long-term and high-dose ACE inhibitor use in individuals carrying the DD genotype of the ACE gene reduces the risk of some cancers (colorectal, lung, breast, and prostate cancer) 4. Thus, simple identification of the ACE I/D gene polymorphism can identify the population to which this treatment can be administered and might significantly contribute to survival in patients with LC.

Finally, our study has some limitations. Firstly, our sample size was relatively small. Secondly, the levels of ACE and AT-2 in tumour tissue and plasma could not be studied quantitatively. We suggest that these parameters be included in evaluations in future studies. Thirdly, we had no LC patients with distant metastasis. Therefore, we could not perform statistical analysis for this parameter.

Conclusions

The findings of the study suggest that ACE genotypes and alleles do not affect the prevalence of LC, but the DD genotype of ACE polymorphism may pose a risk for lymph node metastasis. Well-designed studies with larger sample sizes and more ethnic groups are needed to further validate these results.

Conflict of interest statement

The authors declare no conflict of interest.

Funding

This work was supported by The Coordinatorship of Scientific Research Projects Department (BAP), Suleyman Demirel University (grant number: TSG-2020-8134)

Author contributions

YÇK: conception and design, acquisition of data, analysis and interpretation of data, wrote the manuscript, critical revision of the article, final approveal of the version to be published. KHÖ: conception and design, acquisition of data, analysis and interpretation of data, wrote the manuscript, final approveal of the version to be published. HY: conception and design, wrote the manuscript, critical revision of the article, final approveal of the version to be published. VA: conception and design, acquisition of data, wrote the manuscript, critical revision of the article, final approveal of the version to be published. MES: conception and design, wrote the manuscript, critical revision of the article, final approveal of the version to be published. FC: conception and design, wrote the manuscript, critical revision of the article, final approveal of the version to be published.

Ethical consideration

This study was approved by the Institutional Ethics Committee (Ethics Committee of the Suleyman Demirel University School of Medicine) (approval number/protocol number: 04/09/2020-239).

The research was conducted ethically, with all study procedures being performed in accordance with the requirements of the World Medical Association’s Declaration of Helsinki.

Written informed consent was obtained from each participant/patient for study participation and data publication.

Figures and tables

Figure 1.Gel electrophoresis of PCR-RFLP products from representative blood samples for ACE I/D polymorphism. Lane ladder represents DNA ladder marker (Fermentas). I/I columns show the 490 bp band. I/D columns show the 190 bp and 490 bp bands. D/D columns show the 190 bp bands.

Variables LC patients Controls pa
(n = 44) (n = 61)
n (%)
Age 62.73 ± 9.05 61.93 ± 7.48 0.625
Gender
    Male 44/44 61/61
    Female -/- -/-
Tumour localisation
    Supraglottis 7 (15.90)
    Glottis 35 (79.54)
    Subglottis 2 (4.54)
Tumour extension
    T1 14 (31.8)
    T2 20 (45.5)
    T3 5(11.4)
    T4 5 (11.4)
Nodes
    N0 34 (77.2)
    N1 1 (2.27)
    N2 9 (20.45)
    N3 -
Stage
    S1 14 (31.8)
    S2 16 (36.4)
    S3 5 (11.4)
    S4 9 (20.5)
Table I.Characteristics of LC patients and controls.
LC patients Controls pa
(n = 44) (n = 61)
n (%) n (%)
ACE genotypes
    DD 10 (22.7) 10 (16.4) 0.079
    ID 28 (63.6) 31 (50.8)
    II 6 (13.6) 20 (32.8)
ACE alleles
    D 48 (54.5) 51 (41.8) 0.068
    I 40 (45.5) 71 (58.2)
Table II.Distribution of ACE insertion/deletion polymorphism genotypes and alleles for LC patients and controls.
Clinical parameters pa OR - (CI) - pc
n (%) n (%)
Tumour extension
T1+T2 T3+T4
Genotype
    DD 7 (20.6) 3 (30.0)
    ID 24 (70.6) 4 (40.0) 0.137
    II 3 (8.8) 3 (30.0)
    Allele
    D 38 (55.9) 10 (50.0)
    I 30 (44.1) 10 (50.0) 0.642
Nodes
N- N+
Genotype
    DD 5 (14.7) 5 (50.0) 8.333 - (1.487-46.705) - 0.016
    ID 25 (73.5) 3 (30.0) 0.031 1.00b
    II 4 (11.8) 2 (20.0) 4.167 - (0.522-33.263) - 0.178
    Allele
    D 35 (51.5) 13 (65.0)
    I 33 (48.5) 7 (35.0) 0.285
Stage
S1+S2 S3+S4
Genotype
    DD 5 (16.7) 5 (35.7)
    ID 22 (73.3) 6 (42.9) 0.147
    II 3 (10.0) 3 (21.4)
    Allele
    D 32 (53.3) 16 (57.1)
    I 28 (46.7) 12 (42.9) 0.738
Tumour localisation
Supraglottis Glottis Subglottis
Genotype
    DD 1 (14.3) 9 (25.7) 0 (0)
    ID 4 (57.1) 23 (65.7) 1 (50.0) 0.321
    II 2 (28.6) 3 (8.6) 1(50.0)
    Allele
    D 6 (42.9) 41 (58.6) 1 (25.0)
    I 8 (57.1) 29 (41.4) 3 (75.0) 0.267
Table III.Comparison of ACE genotypes/alleles with clinical parameters of LC patients.

References

  1. Slootweg PJ, Grandis JR. WHO classification of head and neck tumours. International Agency for Research on Cancer: Lyon; 2017.
  2. Cancer Stat Facts: Laryngeal Cancer. 2020. Publisher Full Text
  3. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin. 2016; 66:7-30. DOI
  4. van der Knaap R, Siemes C, Coebergh JW. Renin-angiotensin system inhibitors, angiotensin I-converting enzyme gene insertion/deletion polymorphism, and cancer: the Rotterdam Study. Cancer. 2008; 112:748-757. DOI
  5. Rigat B, Hubert C, Alhenc-Gelas F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990; 86:1343-1346. DOI
  6. Pasha MA, Khan AP, Kumar R. Variations in angiotensin-converting enzyme gene insertion/deletion polymorphism in Indian populations of different ethnic origins. J Biosci. 2002; 27:67-70. DOI
  7. Rachow T, Schiffl H, Lang SM. Risk of lung cancer and renin-angiotensin blockade: a concise review. J Cancer Res Clin Oncol. 2021; 147:195-204. DOI
  8. Dević Pavlić S, Ristić S, Flego V. Angiotensin-converting enzyme insertion/deletion gene polymorphism in lung cancer patients. Genet Test Mol Biomarkers. 2012; 16:722-725. DOI
  9. Röcken C, Lendeckel U, Dierkes J. The number of lymph node metastases in gastric cancer correlates with the angiotensin I-converting enzyme gene insertion/deletion polymorphism. Clin Cancer Res. 2005; 11:2526-2530. DOI
  10. Amin MB, Edge SB, Greene F. AJCC Cancer Staging Manual. Springer International Publishing: New York, NY; 2017.
  11. Dastgheib SA, Asadian F, Farbod M. Association of ACE I/D, -240A &gt; T and AT1R A1166C polymorphisms with susceptibility to breast cancer: a systematic review and meta-analysis based on 35 case-control studies. Nucleosides Nucleotides Nucleic Acids. 2021; 40:117-135. DOI
  12. Wang ZY, Li HY, Jiang ZP. Relationship between angiotensin-converting enzyme insertion/deletion gene polymorphism and prostate cancer susceptibility. J Cancer Res Ther. 2018; 14:375-380. DOI
  13. Raba G, Zawlik I, Braun M. Evaluation of the association between angiotensin converting enzyme insertion/deletion polymorphism and the risk of endometrial cancer in and characteristics of Polish women. Adv Clin Exp Med. 2020; 29:581-585. DOI
  14. Freitas-Silva M, Pereira D, Coelho C. Angiotensin I-converting enzyme gene insertion/deletion polymorphism and endometrial human cancer in normotensive and hypertensive women. Cancer Genet Cytogen. 2004; 155:42-46. DOI
  15. Medeiros R, Vasconcelos A, Costa S. Linkage of angiotensin I-converting enzyme gene insertion/deletion polymorphism to the progression of human prostate cancer. J Pathol. 2004; 202:330-335. DOI
  16. Haiman C, Henderson S, Bretsky P. Genetic variation in angiotensin I-converting enzyme (ACE) and breast cancer risk: the multiethnic cohort. Cancer Res. 2003; 63:6984-6987.
  17. Chung FM, Yang YH, Chen CH. Angiotensin-converting enzyme gene insertion/deletion polymorphism is associated with risk of oral precancerous lesion in betel quid chewers. Br J Cancer. 2005; 93:602-606. DOI
  18. Kürten CHL, Zioga E, Gauler T. Patterns of cervical lymph node metastasis in supraglottic laryngeal cancer and therapeutic implications of surgical staging of the neck. Eur Arch Otorhinolaryngol. 2021; 278:5021-5027. DOI
  19. Zheng X, Liu G, Cui G. Angiotensin-converting enzyme gene deletion polymorphism is associated with lymph node metastasis in colorectal cancer patients in a chinese population. Med Sci Monit. 2017; 23:4926-4931. DOI
  20. Folkman J. Role of angiogenesis in tumor growth and metastasis. Semin Oncol. 2002; 29:15-18. DOI
  21. Fujita M, Hayashi I, Yamashina S. Blockade of angiotensin AT1a receptor signaling reduces tumor growth, angiogenesis, and metastasis. Biochem Biophys Res Commun. 2002; 294:441-447. DOI

Affiliations

Yusuf Çağdaş Kumbul

Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey

Kuyaş Hekimler Öztürk

Department of Medical Genetics, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey

Hasan Yasan

Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey

Vural Akın

Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey

Mehmet Emre Sivrice

Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey

Fatma Caner

Department of Otorhinolaryngology and Head & Neck Surgery, Süleyman Demirel University Faculty of Medicine, Isparta, Turkey

Copyright

© Società Italiana di Otorinolaringoiatria e chirurgia cervico facciale , 2023

  • Abstract viewed - 1038 times
  • PDF downloaded - 307 times